Pegfp

pEGFP Vector Information
Pvu II
Nco I (288)
Bsr GI (999)
Fsp I
Aat II (1424)
lacZ
ATG ACC ATG ATT ACG CCA AGC TTG CAT GCC TGC AGG TCG ACT CTA GAG GAT CCC CGG GTA CCG GTC GCC ACC ATG GTG
Hind III
Sph I
Pst I
Acc I
Bam
HI Xma I Kpn I Age I
Nco I
Sal I
Sma I Asp718 I
Hinc II
EGFP 1010
TAA AGCGGCCGCGACTCTAGAATTCCAACTGAGCGCCGGTCGCTACCATTACCAACTTGTCTGGTGTCAAAAATAATAGGCCT
Not I
Xba I EcoR I
Stu I
Spe I
Bsp120 I
BsiW I Apa I
Restriction Map and Multiple Cloning Site (MCS) of pEGFP Vector. Unique restriction sites are in bold. The Xba I
sites in the MCS can be used together to excise the EGFP gene.
Description:
pEGFP carries a red-shifted variant of wild-type green fluorescent protein (GFP) which has been
optimized for brighter fluorescence and higher expression in mammalian cells. (Excitation maximum
= 488 nm; emission maximum = 507 nm.) pEGFP encodes the GFPmut1 variant (1) which contains
the double-amino-acid substitution of Phe-64 to Leu and Ser-65 to Thr. The coding sequence of the
EGFP gene contains more than 190 silent base changes which correspond to human codon-usage
preferences (2). Upstream sequences flanking EGFP have been converted to a Kozak consensus
translation initiation site (3) to further increase the translation efficiency in eukaryotic cells.
The EGFP gene was cloned between the two MCS of the pUC19 derivative pPD16.43 (4). The EGFPcoding sequence is flanked by separate MCS at the 5' and 3' ends, so the EGFP gene can be easilyexcised from pEGFP. Alternatively, the EGFP coding sequence can be amplified by PCR. The EGFPgene was inserted in frame with the lacZ initiation codon from pUC19 so that a EGFP fusion proteinis expressed from the lac promoter in E. coli. Note, however, that if you excise the EGFP codingsequence using a restriction site in the 5' MCS, the resulting fragment will encode the native (i.e.,non-fusion) EGFP protein. The pUC backbone of EGFP provides a high-copy-number origin ofreplication and an ampicillin resistance gene for propagation and selection in E. coli.
Vector Information
Location of features:
• lac promoter: 95-178
CAP binding site: 111-124-35 region: 143-148; -10 region: 167-172Transcription start point: 179lac operator: 179-199 • lacZ-EGFP fusion protein expressed in E. coli Ribosome binding site: 206-209Start codon (ATG): 217-219; Stop codon: 1006-1008 • 5' Multiple Cloning Site: 234-281• Enhanced green fluorescent protein (EGFP) gene Kozak consensus translation initiation site: 282-292Start codon (ATG): 289-291; Stop codon: 1006-1008Insertion of Val at position 2: 292-294GFPmut1 chromophore mutations (Phe-64 to Leu; Ser-65 to Thr): 481-486His-231 to Leu mutation (A→T): 983 • 3' Multiple Cloning Site: 1010-1109• Ampicillin resistance gene Promoter: -35 region: 1485-1490; -10 region: 1508-1513Transcription start point: 1520Ribosome binding site: 1543-1547 Start codon (ATG): 1555-1557; Stop codon: 2413-2415 • pUC plasmid replication origin: 2563-3206 Primer location:
• EGFP-N Sequencing Primer (#6479-1): 355-334
• EGFP-C Sequencing Primer (#6478-1): 942-963
Propagation in E. coli:
• Recommended host strain: JM109
• Selectable marker: plasmid confers resistance to ampicillin (100 µg/ml) to E. coli hosts
• E. coli replication origin: pUC
• Copy number: ~500
• Plasmid incompatibility group: pMB1/ColE1
References:
1. Cormack, B., et al. (1996) Gene 173:33-38.
2. Haas, J., et al. (1996) Curr. Biol. 6:315-324.
3. Kozak, M. (1987) Nucleic Acids Res. 15:8125-8148.
4. Fire, A., et al. (1990) Gene 93:189-198.
Note: The attached sequence file has been compiled from information in the sequence databases, published
literature, and other sources, together with partial sequences obtained by BD Biosciences Clontech. This vector has
not been completely sequenced.
Notice to Purchaser
Use of BD Biosciences Clontech's Living Colors™ products containing DNA sequences coding for mutant Aequorea victoria green fluorescentprotein (GFP) variants or proteins thereof requires a license from Amersham Biosciences under U.S. Patent Nos. 5,625,048; 5,777,079; 6,054,321and other pending U.S. and foreign patent applications. In addition, certain BD Biosciences Clontech products are made under U.S. Patent No.
5,804,387 licensed from Stanford University.
Not-For-Profit research institutes or entities are granted an automatic license with the purchase of this product for use in non-commercial internalresearch purposes, the terms of which are disclosed in detail in the license that accompanies the shipment of this product. Such license specifi-cally excludes the right to sell or otherwise transfer this product or its components to third parties.
For-Profit research institutes or entities must obtain a license from Amersham Biosciences. E-mail: gfp@amershambiosciences.com Please contact BD Biosciences Clontech directly for any other assistance, including purchasing and technical support. All companies andinstitutions purchasing Living Colors™ products will be included in a quarterly report to Aurora Biosciences, as required by the BD BiosciencesClontech/Aurora Biosciences license agreement.
This product is intended to be used for research purposes only. It is not to be used for drug or diagnostic purposes nor is it intended for humanuse. BD Biosciences Clontech products may not be resold, modified for resale, or used to manufacture commercial products without writtenapproval of BD Biosciences Clontech.
BD Biosciences Clontech
www.bdbiosciences.com
Protocol # PT3078-5
Version # PR29965

Source: http://epimed.uniandes.edu.co/epimed/Fluorescente_files/pEGFP.pdf